Insertion junction: LMJ.RY0402.038456_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038456
Chromosome:chromosome_12
Location:1213830
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre12.g489500 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GGGCGGTGACGTGCGGCACCCGGTGGGCCG
Internal bar code:TGCATGCCGTGATATAGGGTTT

Confirmation - LEAP-Seq

LEAP-Seq distance:914
LEAP-Seq percent confirming:97.415
LEAP-Seq n confirming:3354
LEAP-Seq n nonconfirming:89
LEAP-Seq n unique pos:20

Suggested primers for confirmation by PCR

Suggested primer 1:ATCATCCTTGCTCCGGTATG
Suggested primer 2:GCTCCAGAAGAAGCGAAATG