Insertion junction: LMJ.RY0402.038457_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038457
Chromosome:chromosome_9
Location:1287117
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre09.g399150 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TACAGCACCCCCTTTCATGAGATGAAGACC
Internal bar code:CCGGCCGACCGAATCTTATTTG

Confirmation - LEAP-Seq

LEAP-Seq distance:948
LEAP-Seq percent confirming:99.5385
LEAP-Seq n confirming:12295
LEAP-Seq n nonconfirming:57
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:CACACACACACACACACCGT
Suggested primer 2:GTGGGTGACGTTTCTGTGTG