Insertion junction: LMJ.RY0402.038464_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038464
Chromosome:chromosome_3
Location:1902457
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre03.g155051 SPA1 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GCAAACGCGTACACGGTGGCCGAGCCCCAT
Internal bar code:GCCGAACCTAGCAACTAAGTTT

Confirmation - LEAP-Seq

LEAP-Seq distance:270
LEAP-Seq percent confirming:99.4709
LEAP-Seq n confirming:2444
LEAP-Seq n nonconfirming:13
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:AATGGAGTTACCGCATGGAG
Suggested primer 2:CCTCGCAGTTTCCTGACTTC