Insertion junction: LMJ.RY0402.038464_3

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038464
Chromosome:chromosome_6
Location:6509099
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre06.g293150 PGM12 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTTTTTTCGGCAAACAGACGAAGACAGTTT
Internal bar code:CGTCCCTACCTGCGCATGGGTG

Confirmation - LEAP-Seq

LEAP-Seq distance:399
LEAP-Seq percent confirming:93.6951
LEAP-Seq n confirming:1813
LEAP-Seq n nonconfirming:122
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR

Suggested primer 1:GGCACATGATTTGTTTGTGC
Suggested primer 2:AGTGGCGACTTTTAGCCTGA