Insertion junction: LMJ.RY0402.038464_4

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038464
Chromosome:chromosome_6
Location:6509112
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre06.g293150 PGM12 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCGTTTTGGCCGAAATTTCAAGTCAAGAT
Internal bar code:GCGCGAGCCGGCGATGGGTGCA

Confirmation - LEAP-Seq

LEAP-Seq distance:455
LEAP-Seq percent confirming:99.6504
LEAP-Seq n confirming:570
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:AGTGGCGACTTTTAGCCTGA
Suggested primer 2:GGCACATGATTTGTTTGTGC