Insertion junction: LMJ.RY0402.038465_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038465
Chromosome:chromosome_16
Location:2320697
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g659450 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GCGGGAGAAGGGAAACGCGAATCCGTGTGT
Internal bar code:GCTCCTCATTGTACGGGACGCC

Confirmation - LEAP-Seq

LEAP-Seq distance:517
LEAP-Seq percent confirming:99.7283
LEAP-Seq n confirming:734
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:CATCTACATGGACACCGACG
Suggested primer 2:TCCACTTCCACCTCTTCCAC