Insertion junction: LMJ.RY0402.038465_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038465
Chromosome:chromosome_16
Location:2321455
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g659450 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ATCTTTGCAACCCCTCCCCCGCGCCCCCCC
Internal bar code:CTCTCTCCCGACTGAAAGCTCG

Confirmation - LEAP-Seq

LEAP-Seq distance:365
LEAP-Seq percent confirming:99.3424
LEAP-Seq n confirming:6647
LEAP-Seq n nonconfirming:44
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GGTTCACTGAGGAGCCCATA
Suggested primer 2:GATACACGCCAGGGTCAACT