Insertion junction: LMJ.RY0402.038469_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038469
Chromosome:chromosome_8
Location:4620299
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre08.g383400 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGACCGTGCGTGGAAGGTGGCGACTGTCG
Internal bar code:GGGCACCGTGGTCCTTGCTCTG

Confirmation - LEAP-Seq

LEAP-Seq distance:534
LEAP-Seq percent confirming:99.7602
LEAP-Seq n confirming:8736
LEAP-Seq n nonconfirming:21
LEAP-Seq n unique pos:31

Suggested primers for confirmation by PCR

Suggested primer 1:GCACAGGATTATTTTGCCGT
Suggested primer 2:CCCTTGCACTCACAGTCGTA