Insertion junction: LMJ.RY0402.038472_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038472
Chromosome:chromosome_2
Location:4517265
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre02.g100500 CYG22 Adenylate/guanylate cyclase antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ATTCCACGGTACGATCGTGGATAAACAAGT
Internal bar code:AGAGAGGTCTGCCGGACACTCC

Confirmation - LEAP-Seq

LEAP-Seq distance:354
LEAP-Seq percent confirming:98.3064
LEAP-Seq n confirming:1219
LEAP-Seq n nonconfirming:21
LEAP-Seq n unique pos:11

Suggested primers for confirmation by PCR

Suggested primer 1:AGAGGGTGTATTGGGTGCTG
Suggested primer 2:COULD_NOT_FIND_PRIMER