Insertion junction: LMJ.RY0402.038473_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038473
Chromosome:chromosome_14
Location:1494724
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre14.g618300 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TAAGCTTTGTAAGCTACGCAAAAACGTCAG
Internal bar code:CGTTGATGTGAGCAGGCCAGCT

Confirmation - LEAP-Seq

LEAP-Seq distance:629
LEAP-Seq percent confirming:98.579
LEAP-Seq n confirming:2775
LEAP-Seq n nonconfirming:40
LEAP-Seq n unique pos:13

Suggested primers for confirmation by PCR

Suggested primer 1:ATCCCCCTTCGAGTTGACTT
Suggested primer 2:TCAAGCCACGTCAGCACTAC