Insertion junction: LMJ.RY0402.038474_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038474
Chromosome:chromosome_17
Location:3204227
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre17.g722150 PKS3 Type III polyketide synthase sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCGGCGGTACGAGGCGGTACGACGGCGGC
Internal bar code:TTGTACGTGCGGCTATTTCCCG

Confirmation - LEAP-Seq

LEAP-Seq distance:987
LEAP-Seq percent confirming:98.8023
LEAP-Seq n confirming:4702
LEAP-Seq n nonconfirming:57
LEAP-Seq n unique pos:36

Suggested primers for confirmation by PCR

Suggested primer 1:AACCCAAGTAGCCCTCACCT
Suggested primer 2:TGGTCACGTTGATCTTCAGC