| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.038474 |
| Chromosome: | chromosome 17 |
| Location: | 3204229 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722150 | PKS3 | (1 of 1) 2.3.1.119//2.3.1.199 - Transferred entry: 1.1.1.330, 1.3.1.93, 2.3.1.199 and 4.2.1.134 // Very-long-chain 3-oxoacyl-CoA synthase / Very-long-chain beta-ketoacyl-CoA synthase; Type III polyketide synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACCCTACTCATTCCCCACAACAGCATC |
| Internal bar code: | TTCTCGTGTTGATAACAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 964 |
| LEAP-Seq percent confirming: | 99.8192 |
| LEAP-Seq n confirming: | 1104 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCCAAGTAGCCCTCACCT |
| Suggested primer 2: | TGGTCACGTTGATCTTCAGC |