Insertion junction: LMJ.RY0402.038474_2


Insertion cassette:CIB1
Side of cassette:5'
Confidence (%):95
Locus systematic id Locus common name Defline Orientation Feature
Cre17.g722150 PKS3 Type III polyketide synthase sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CATACCCTACTCATTCCCCACAACAGCATC

Confirmation - LEAP-Seq

LEAP-Seq distance:964
LEAP-Seq percent confirming:99.8192
LEAP-Seq n confirming:1104
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR