Insertion junction: LMJ.RY0402.038480_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.038480
Chromosome:chromosome_16
Location:3554816
Confidence (%):58
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g679876 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CGTCTGGGCTGAACCGCAGCCGCAGGGTCT
Internal bar code:GTCAGAGGCCGGAAATTCCTCG

Confirmation - LEAP-Seq

LEAP-Seq distance:403
LEAP-Seq percent confirming:99.6377
LEAP-Seq n confirming:3850
LEAP-Seq n nonconfirming:14
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:CCCCTCGTTTCTCTGTACCA
Suggested primer 2:CCCCATACGTCTCTCTGAGC