| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.038561 |
| Chromosome: | chromosome 1 |
| Location: | 4311280 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029150 | DAU1,DNAAF1,LRRC50,ODA7,ODA7A | (1 of 2) PTHR24365:SF315 - DYNEIN ASSEMBLY FACTOR 1, AXONEMAL; Outer row dynein assembly protein 7 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGTTGTGCGTGGCGATGAGCGTTCGCAG |
| Internal bar code: | TTATCTCGTATCACTTAATTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1174 |
| LEAP-Seq percent confirming: | 99.1352 |
| LEAP-Seq n confirming: | 82538 |
| LEAP-Seq n nonconfirming: | 720 |
| LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCCATAGACTCAAAGCA |
| Suggested primer 2: | TCGATAGTTGCCTACGACCC |