| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.038600 |
| Chromosome: | chromosome_9 |
| Location: | 4986335 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre09.g397993 | Similar to Flagellar Associated Protein FAP201 | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | TGGGGGGTGCGGAGGGGTTAGAAGCGATTG |
| Internal bar code: | AGTCGTCTGATCCAAGGGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 257 |
| LEAP-Seq percent confirming: | 99.0375 |
| LEAP-Seq n confirming: | 21917 |
| LEAP-Seq n nonconfirming: | 213 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGGGAAGGGACATTGCTT |
| Suggested primer 2: | TGGTTCTGGGTCTTGGTTTC |