Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.038680 |
Chromosome: | chromosome 1 |
Location: | 4325225 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g029250 | AAH1 | Aromatic amino acid hydroxylase-related protein; (1 of 1) PF00351 - Biopterin-dependent aromatic amino acid hydroxylase (Biopterin_H) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCTTCCTGCGAGAGCGCTTGAGACACCT |
Internal bar code: | ACAGTTATTAATCTGAGCTCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 966 |
LEAP-Seq percent confirming: | 99.5747 |
LEAP-Seq n confirming: | 4683 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTGAAGAACGTTCGGAGC |
Suggested primer 2: | GCAACATCAGGAGTCAGCAA |