| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.038691 |
| Chromosome: | chromosome 9 |
| Location: | 4986229 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397993 | FAP201 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype; Leucine Rich Repeat Flagellar Associated Protein 201 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGGGTGGAAAGCGAGTGGATGGTAGGGC |
| Internal bar code: | TCAAGCCGCCGATTTAAAGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 535 |
| LEAP-Seq percent confirming: | 99.5244 |
| LEAP-Seq n confirming: | 6905 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTTCTGGGTCTTGGTTTC |
| Suggested primer 2: | AAAGGGAAGGGACATTGCTT |