Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.038698 |
Chromosome: | chromosome 7 |
Location: | 1011491 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g319350 | (1 of 40) PTHR23257//PTHR23257:SF513 - SERINE-THREONINE PROTEIN KINASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCAGCGTCAGCCGCTATTGCGGCAGCAA |
Internal bar code: | CAGTGTCAAAAGCCAGTGAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 187 |
LEAP-Seq percent confirming: | 99.3939 |
LEAP-Seq n confirming: | 328 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTAAACGGCCCAGGAAGT |
Suggested primer 2: | GAGAGGCAGGCATCGAGTAG |