Insertion junction: LMJ.RY0402.038708_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038708
Chromosome:chromosome_13
Location:3460986
Confidence (%):95
Locus systematic id Locus common name Defline Orientation Feature
Cre13.g587550 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TTACTGGTGCTCCATGCTGATTTCCCGCTG
Internal bar code:ACATGCGGCGCTTCGTGGGGGC

Confirmation - LEAP-Seq

LEAP-Seq distance:78
LEAP-Seq percent confirming:78.1609
LEAP-Seq n confirming:204
LEAP-Seq n nonconfirming:57
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:CCCCCTCTTGTAACGTCGTA
Suggested primer 2:AAAGGCAGATGTCGACCAAG