Insertion junction: LMJ.RY0402.038724_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038724
Chromosome:chromosome_12
Location:1081074
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g490850 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCGGCGCAGTACCCCGGACCCATGGGGCC
Internal bar code:CATTGATGTTCTTCAAAAGGAT

Confirmation - LEAP-Seq

LEAP-Seq distance:816
LEAP-Seq percent confirming:85.5994
LEAP-Seq n confirming:1064
LEAP-Seq n nonconfirming:179
LEAP-Seq n unique pos:50

Suggested primers for confirmation by PCR

Suggested primer 1:TTTGTTCTCACTGCCTCACG
Suggested primer 2:CAACCTCACACCACCTCCTT