| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.038760 |
| Chromosome: | chromosome 7 |
| Location: | 1046863 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319600 | FAE3 | (1 of 3) K15397 - 3-ketoacyl-CoA synthase (KCS); Putative 3-keto-acyl-CoA synthase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCGCGAAGGGCCTGTGCGTGGATATAC |
| Internal bar code: | ATGGGCTTGAATTGTGGGTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 419 |
| LEAP-Seq percent confirming: | 99.7297 |
| LEAP-Seq n confirming: | 7010 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCATTCCAATCCCAAATG |
| Suggested primer 2: | TACCTACCCATCTGCTTGCC |