| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.038825 |
| Chromosome: | chromosome 16 |
| Location: | 7587116 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689423 | (1 of 14) PF00892 - EamA-like transporter family (EamA); Putative UDP-galactose transporter | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGGTGCAATGACTGCTCACTAGCTGATG |
| Internal bar code: | TCATATCTTTAGCAATTCCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 679 |
| LEAP-Seq percent confirming: | 98.8629 |
| LEAP-Seq n confirming: | 5999 |
| LEAP-Seq n nonconfirming: | 69 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTTGAATGGTGGCAAAG |
| Suggested primer 2: | ACACACCACCCTGCCTTTAG |