| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.038874 |
| Chromosome: | chromosome 8 |
| Location: | 1066817 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g362150 | FAP361,FAP154 | Flagellar Associated Protein 361 with PAS Sensory Domain; (1 of 28) PTHR31600//PTHR31600:SF2 - FAMILY NOT NAMED // TINY MACROCYSTS PROTEIN B-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGATCCACATGGTCGCAGCGACACCGCA |
| Internal bar code: | ACGCTCAAAACGCTTAATGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 131 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACAGGATAAGGAATGGGC |
| Suggested primer 2: | GTCGTGCACAGCTACTTGGA |