| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.038968 |
| Chromosome: | chromosome 12 |
| Location: | 5387670 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529850 | (1 of 6) PTHR10582 - TRANSIENT RECEPTOR POTENTIAL ION CHANNEL PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGTATGACATGCGCTAGTACGGCGCTCA |
| Internal bar code: | ACGATGATAATGCCTAACAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 99.3764 |
| LEAP-Seq n confirming: | 12429 |
| LEAP-Seq n nonconfirming: | 78 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGCAGAATTACAAGCAAC |
| Suggested primer 2: | GTATGGACCTTGTCCGTGCT |