Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.039009 |
Chromosome: | chromosome 7 |
Location: | 5864984 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g353650 | (1 of 29) PF00612 - IQ calmodulin-binding motif (IQ) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCCGCTACCGCTCCCGCCGCCCGCCCT |
Internal bar code: | AGGATCGCCCCGCCGGCTGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 92 |
LEAP-Seq percent confirming: | 72.381 |
LEAP-Seq n confirming: | 76 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAAGTACCTTGGGGCAGTC |
Suggested primer 2: | CTTCGTCCTAGGGGAGCAC |