| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.039041 |
| Chromosome: | chromosome_6 |
| Location: | 2938574 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre06.g272800 | RPS8 | Ribosomal protein S8, component of cytosolic 80S ribosome and 40 | antisense | 3'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GTCGGTTTCTCATTTACTCTCTAGACCATG |
| Internal bar code: | GGGAGCCGCAAGGACATTGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 907 |
| LEAP-Seq percent confirming: | 99.3408 |
| LEAP-Seq n confirming: | 11152 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTTGACAAGAAAGGTGGT |
| Suggested primer 2: | GGTAGGGGAATCAACGTGAA |