| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.039068 |
| Chromosome: | chromosome 3 |
| Location: | 8480576 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g200543 | MCP15 | (1 of 1) K15108 - solute carrier family 25 (mitochondrial thiamine pyrophosphate transporter), member 19 (SLC25A19, DNC, TPC1); Mitochondrial substrate carrier protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCGGCTTACACGCATGCACACAGCTTTG |
| Internal bar code: | GGACCCCAGGTAACGACCGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 317 |
| LEAP-Seq percent confirming: | 98.8194 |
| LEAP-Seq n confirming: | 3097 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTCAAAGCGTTGTTTGTT |
| Suggested primer 2: | CGGAGAAGATGGGCATTAAA |