Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.039071 |
Chromosome: | chromosome 12 |
Location: | 4782634 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g524150 | POLH2,POLI2 | (1 of 2) K03509 - DNA polymerase eta (POLH); DNA polymerase eta | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTTGGGATGCCAGCAGCCCAGCGGGCAC |
Internal bar code: | TAAGGATCATGGCCCTGGCGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 372 |
LEAP-Seq percent confirming: | 97.0937 |
LEAP-Seq n confirming: | 7216 |
LEAP-Seq n nonconfirming: | 216 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTGTAAATACCAGCCCAA |
Suggested primer 2: | ATTGGCGTGCATTTGATACA |