| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.039115 |
| Chromosome: | chromosome 17 |
| Location: | 3584944 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725750 | (1 of 3) K11089 - 60 kDa SS-A/Ro ribonucleoprotein (TROVE2, SSA2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATATAGTATAACCGTATATATCCAGCTAG |
| Internal bar code: | GATATTTGATCGGCGTCGAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 539 |
| LEAP-Seq percent confirming: | 90.552 |
| LEAP-Seq n confirming: | 3642 |
| LEAP-Seq n nonconfirming: | 380 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGCAGCTCATGCTAATGT |
| Suggested primer 2: | CTAGCCTCTGCCCATCAGTC |