| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.039143 |
| Chromosome: | chromosome 9 |
| Location: | 2043519 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394200 | FAS9,FLA4,FAP102 | Flagellar Associated Protein 102; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTCAATAGTGAACAAATTGCCGGAACC |
| Internal bar code: | CCGTAATAAGTATGGGTGTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 832 |
| LEAP-Seq percent confirming: | 99.2422 |
| LEAP-Seq n confirming: | 5631 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAAGTTGCTACTCGCCTT |
| Suggested primer 2: | GGCTAGTAGGTGTCACCCCA |