| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.039149 |
| Chromosome: | chromosome 13 |
| Location: | 1355694 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571560 | (1 of 1) PF09737 - De-etiolated protein 1 Det1 (Det1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGTGCAGACCATATGAGCTCCGTGAGAC |
| Internal bar code: | TGCATCTTGTCGCACATTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 387 |
| LEAP-Seq percent confirming: | 99.0277 |
| LEAP-Seq n confirming: | 1324 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTTTCGACACACTGTCC |
| Suggested primer 2: | ACTCGTCGATGGAACTGGTC |