Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.039188 |
Chromosome: | chromosome 2 |
Location: | 5272557 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g106500 | DIPP1,IPP2,DIPP | Inositol-phosphate phosphatase; (1 of 1) K07766 - diphosphoinositol-polyphosphate diphosphatase (E3.6.1.52) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATATGTACGCCTTGCAGCGCCCCGGCGT |
Internal bar code: | AAGTACGTTGCTTCTTGTTTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 405 |
LEAP-Seq percent confirming: | 99.7514 |
LEAP-Seq n confirming: | 8828 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACAAGCAACGCTATGGAGA |
Suggested primer 2: | TACGGGGCAAGACTACAACC |