| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.039188 |
| Chromosome: | chromosome 13 |
| Location: | 2452499 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g579901 | DEG6 | (1 of 2) PTHR22939:SF67 - PROTEASE DO-LIKE 9; Deg protease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCTGGCGGTGATCAGGGAAGGGGGTAA |
| Internal bar code: | CAGGGTCCGAGTGCTACCCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 660 |
| LEAP-Seq percent confirming: | 98.6314 |
| LEAP-Seq n confirming: | 1081 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAACCAGAAGGTGGGGAG |
| Suggested primer 2: | ATCATAGGGAGGAGGCTGGT |