| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.039316 |
| Chromosome: | chromosome 12 |
| Location: | 2850345 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g502250 | PLP4,PLAP4 | Plastid lipid associated protein 4; (1 of 17) PF04755 - PAP_fibrillin (PAP_fibrillin) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTCCTCGCCGCCTCACGCTGCCGCCGG |
| Internal bar code: | ACTAATCTTCGTGTTCCCGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTCTACTCGGCCTTGAC |
| Suggested primer 2: | GAGTTGCCAAGACCTCAAGC |