| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.039349 |
| Chromosome: | chromosome 1 |
| Location: | 3616479 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g023300 | (1 of 1) 1.1.1.370 - Scyllo-inositol 2-dehydrogenase (NAD(+)) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGTGCTCGTCTCCACAGCTCATCCGTGG |
| Internal bar code: | GTTTGGCAAGGAAAGTAAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 46 |
| LEAP-Seq percent confirming: | 4.6875 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 61 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATTACCGACCGGCACACT |
| Suggested primer 2: | TTCTGGTTTCCGGTTTTACG |