| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.039358 |
| Chromosome: | chromosome 4 |
| Location: | 1207577 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215400 | AKC3 | conserved expressed protein related to ABC1/COQ8 mitochondrial putative ser/thr kinase; (1 of 2) PTHR10566//PTHR10566:SF86 - CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -RELATED // ABC1 PROTEIN KINASE 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCCAGCGCCACCACTTTGGGCCCTTCC |
| Internal bar code: | CGATCAAGACGACCAGGTGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 287 |
| LEAP-Seq percent confirming: | 93.5421 |
| LEAP-Seq n confirming: | 478 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAACTCGGCTAGTTTGGCT |
| Suggested primer 2: | ACAGTTCCCCACGACAGTTC |