Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.039393 |
Chromosome: | chromosome 9 |
Location: | 1788695 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396250 | VTE5 | Phosphatidate cytidylyltransferase; (1 of 1) K18678 - phytol kinase (VTE5) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTAGAAGTTTTGCCGTCGACCAGATTCCT |
Internal bar code: | CCTGCTTAGACGGTGTCCCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1171 |
LEAP-Seq percent confirming: | 98.5289 |
LEAP-Seq n confirming: | 12257 |
LEAP-Seq n nonconfirming: | 183 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTACTGCCCGTAACTTGT |
Suggested primer 2: | TAGAGTCCCTGCCCATCAAC |