| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.039411 |
| Chromosome: | chromosome 3 |
| Location: | 5306183 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g183700 | BGS1,GSL3,GTR10 | Glucan synthase-like 3; (1 of 4) K00706 - 1,3-beta-glucan synthase (E2.4.1.34) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGACCCCCACACCTGCTGCGAGCCTCA |
| Internal bar code: | GGATTTTTAGGGAGATAGCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 48 |
| LEAP-Seq percent confirming: | 10.4308 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 395 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | GAGTGAGGTTGCTGGAGAGG |