| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.039413 |
| Chromosome: | chromosome 10 |
| Location: | 2417670 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435650 | HGPT1,HPT1 | Hexose/glycerol-3-phosphate transporter; (1 of 2) PTHR11662//PTHR11662:SF272 - SODIUM-DEPENDENT PHOSPHATE TRANSPORTERS // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCGGGTGGTAACATATGCAGCCAATGCA |
| Internal bar code: | CACGATGCGTCGCGTTTAGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 612 |
| LEAP-Seq percent confirming: | 99.6261 |
| LEAP-Seq n confirming: | 6928 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACACTCCACCTCC |
| Suggested primer 2: | AAGCGAGTTCAAGGAAACGA |