Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.039490 |
Chromosome: | chromosome 9 |
Location: | 1447485 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g398350 | (1 of 2) K10597 - ubiquitin conjugation factor E4 B (UBE4B, UFD2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTCGGGGAGCTCGGGATGGCTGGTGGG |
Internal bar code: | TATTTTAGATAATTACTGCCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 345 |
LEAP-Seq percent confirming: | 98.9547 |
LEAP-Seq n confirming: | 1420 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTTCCGTCAACATTTCCT |
Suggested primer 2: | GTGCAGAGTACCTGGTGGGT |