Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.039538 |
Chromosome: | chromosome 10 |
Location: | 2880380 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g439900 | HSP70G | ER-located HSP110/SSE-like protein; (1 of 1) K09486 - hypoxia up-regulated 1 (HYOU1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGAGGCGGCGGCACGACGCCGCTGCTGC |
Internal bar code: | TCTAGTAAAGCTGTAGAATGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 626 |
LEAP-Seq percent confirming: | 98.9854 |
LEAP-Seq n confirming: | 4195 |
LEAP-Seq n nonconfirming: | 43 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAAGACAGTCAGTGCGACC |
Suggested primer 2: | CCCTCTCCTCGTTCTCACTG |