Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.039695 |
Chromosome: | chromosome 7 |
Location: | 3949482 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g339450 | (1 of 12) IPR004843//IPR029052 - Calcineurin-like phosphoesterase domain, apaH type // Metallo-dependent phosphatase-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATCCCCACGGGCCACGGACTGCGCAGCG |
Internal bar code: | ACTTGATATTAGAACGGGACGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 607 |
LEAP-Seq percent confirming: | 98.2383 |
LEAP-Seq n confirming: | 2342 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCCGTGTACAGTTGCTAGA |
Suggested primer 2: | GTAGCAGTAGCAACCCCAGC |