| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.039730 |
| Chromosome: | chromosome 16 |
| Location: | 2657485 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662000 | HEL62 | (1 of 1) K17679 - ATP-dependent RNA helicase MSS116, mitochondrial [EC:3.6.4.13] (MSS116); DEAD/DEAH box helicase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTTTCGGGCCAGTTTTGCACCAGAACGA |
| Internal bar code: | ACTTGCCACCCCGACTACTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 936 |
| LEAP-Seq percent confirming: | 88.4956 |
| LEAP-Seq n confirming: | 1600 |
| LEAP-Seq n nonconfirming: | 208 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATCGGCTGGAACGTAATA |
| Suggested primer 2: | CAGGTCGCAAGTGTGTCAGT |