Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.039798 |
Chromosome: | chromosome 4 |
Location: | 1903079 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g218050 | RWP8 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAATCACTGCTCACACCTCCCTCCACAG |
Internal bar code: | ATCGTATGCGGCACCTTTGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 983 |
LEAP-Seq percent confirming: | 98.9764 |
LEAP-Seq n confirming: | 22724 |
LEAP-Seq n nonconfirming: | 235 |
LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCTTCATTCAGCACCGTGA |
Suggested primer 2: | AGTGGTTGTCGTGTGAGCAG |