| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.039888 |
| Chromosome: | chromosome 6 |
| Location: | 2843627 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g271700 | (1 of 2) 3.4.17.4 - Gly-Xaa carboxypeptidase / Glycine carboxypeptidase; Metallopeptidase M20 family protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCATGGTCCTGCCCTACCATTCCTCAAA |
| Internal bar code: | GCAATTCAGCGGTAGCGCCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 498 |
| LEAP-Seq percent confirming: | 99.657 |
| LEAP-Seq n confirming: | 5521 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTAGTGTGGTGGTTCGGC |
| Suggested primer 2: | CTCTTTCTTCCACCGCTTTG |