| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.039905 |
| Chromosome: | chromosome 17 |
| Location: | 4875722 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734300 | AGI1 | (1 of 2) PTHR10903//PTHR10903:SF47 - GTPASE, IMAP FAMILY MEMBER-RELATED // TRANSLOCASE OF CHLOROPLAST 120, CHLOROPLASTIC-RELATED; Putative Avirulence-Induced Gene AGI1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACTTTAATCCTCCCTCAGCCCCGCTGC |
| Internal bar code: | CGTAGCCGATCGCCATCCTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 813 |
| LEAP-Seq percent confirming: | 98.7365 |
| LEAP-Seq n confirming: | 2110 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGGAAAGAAGAGGGCAG |
| Suggested primer 2: | ATGACAGTGGGGATTGTGGT |