Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.039916 |
Chromosome: | chromosome 9 |
Location: | 4856834 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g397586 | (1 of 2) IPR000719//IPR001245//IPR002290//IPR011009//IPR017986//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // WD40-repeat-containing domain // Tyrosine-protein kinase, catalytic domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGGTCGACGAAGGACATGCTGCTCTGC |
Internal bar code: | CGTGAGGTGCTCCGGATAACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 887 |
LEAP-Seq percent confirming: | 99.6291 |
LEAP-Seq n confirming: | 4567 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTGAAATTGCTGCAAACA |
Suggested primer 2: | GACTGCATGTGTGTCTCGCT |