| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.039932 |
| Chromosome: | chromosome 7 |
| Location: | 1664749 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325350 | KIN4-3,KIN10A,KIN10-1 | Kinesin motor protein; (1 of 4) K10395 - kinesin family member 4/21/27 (KIF4_21_27) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGGACCTTGCACACCTTCCAACAAGAA |
| Internal bar code: | TTTTTGTACGTCGGTGACACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 374 |
| LEAP-Seq percent confirming: | 97.4684 |
| LEAP-Seq n confirming: | 231 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCAGGAAACATTTGCCAT |
| Suggested primer 2: | TGACAGTAGCTGGCAGATGG |