| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.039968 |
| Chromosome: | chromosome 6 |
| Location: | 7507089 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300500 | ADCY1,CYA18 | Adenylyl cyclase; (1 of 1) PTHR11347//PTHR11347:SF132 - CYCLIC NUCLEOTIDE PHOSPHODIESTERASE // PDE1C, ISOFORM E | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGACTCTTCTTGGTGGTGGTGCAAGTT |
| Internal bar code: | GAGTGATGATTTGGTTAGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 345 |
| LEAP-Seq percent confirming: | 99.6531 |
| LEAP-Seq n confirming: | 2298 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACGCAGGTAATCC |
| Suggested primer 2: | GCATCTGTGCTTGTGTGCTT |