| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.039980 |
| Chromosome: | chromosome 12 |
| Location: | 8296693 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549950 | (1 of 1) IPR007305//IPR011691//IPR020846 - Vesicle transport protein, Got1/SFT2-like // Vesicle transport protein, SFT2-like // Major facilitator superfamily domain; SFT2-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAACTCGCACGCGCCCTGTCACAGCAACC |
| Internal bar code: | GGAGATGTCTTCCGGCGACTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 790 |
| LEAP-Seq percent confirming: | 96.6568 |
| LEAP-Seq n confirming: | 983 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGCGTTAAACGGCTTGAT |
| Suggested primer 2: | TTAAGTGCTGCACATGCCTC |